Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ608001
Length 802 bp
Fasta Format > rwhva15e19
ttaacttatatatgatgtcttttgatcacaggacgatcaaattatgcatc acatggtagtacaattcctcgtcagaaaatggtaaaagaaaaaaggttct attgcttatggcgaattcacatcgggccatcccggcatccagtactggaa aataacgagtacgcactccatggcattggattcacatcggtcggtcggac ggtcggacgatatcttgatatatgtacgcgtttgtattcgcatgtatata taggagttaaccggtggggaagatttactgctcccatgtctcgaacttgc cggagacgaagtcgtagtggccgccaacgagcttgagggttccgttggac acaccctccttgacgaacgggtaggtcaagaggttctggagggacacgtt cacggcctccttttcgaggacggtgcactggtcatcgaaaggcattgagg cgcactcagtctgcaccttcttcttggccgggaagccgatcctgacccag tcctcgacgaagtggaaggagtcgtctgcgccatccttgagtgagaggag agccttgattccaccgcagcggctgtggccaatcaccacgatgacctcaa ccttgagagcacagacggcgtattcgatggccgatccaacaccagcgtac ttgttcttgcagtaggacgggaccatgttggcgatgttgcggatggtgaa ggcctcgccgggctccaggcccagggtgaccgaggggcacacacgggagt cggcgcacgcgaacaccatgtacttgggcgcctggccggccttgangggc tc
Download
page-top