Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607998
Length 881 bp
Fasta Format > rwhva15e16
tgtagcatagatgtaccgatgcaattctacagttacaacagcctagtgcc ataactacgacattgtatggataaatcattgtacacgaataatcacggaa ctagatagcgacatagtaacaacaatgctctcttgtctttcttcattcct cgcacagagagaagggggctttgaagaggattattctataaaaattgctc tacagcaggaatcctctaccctcattgcaaaggaagatccttgtgggtgt acacaactcccttgtcaccgttcactacttgtccactccctcgcagaatg caccgagtggttaaaagaccgtcgacgccaacaggtccacgggcatgtat gcgccctgtacttatgccaacctctgcacctagaccaaagcgagtcccat cacagaaccttgtgcttgcattatggaacacagcagcactgtcaacttgt tgtagaaaagtatccgctgacttcttatcagttgtgataatacaatctgt gtgtgcacttccataacgatttatatggtcaatcgctgactgcacatcat caacaaattcgagggtgcatgccattgagctatactcatgatgaaatgaa tctaccttcggtactttcaatgtgtcatgtgcgacaggcccaccataaat aacaactccttctttcgcaagttccatcaataaatcatcaagaccctctg tcttgttcagatctttatgaacaagcagtgtttccatagcattacacgct gcaggataatcaacctttgcatccaatactatacgttttgccatgtccat gtcagctgatttatcaatataaacatggcagataccatcagcatgaccca gaacgggaatcttggtttgtgctttgatttg
Download
page-top