Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607995
Length 614 bp
Fasta Format > rwhva15e11
aacatcaatacaacaggtggtggcctgccatgcagagctggccggacgta ggtactcctctcgctgtcacgcagtgagataatatgagagcacttattca tatatatgtatatgtatgtgtatgacctcaacgtactcagcgtagatcgc tggagctatatgcagcgatgatgagaagaagtggtcgatcaacgaatctt agaacagtccacagatgagctgatggcgtaggggacgctgacgccgcact ttgaagggatgccggcggccttgccagcgttgagcccaccagcagcgctc ttgatgcacttgcacgctgcttgcttgtcagcggtgctccgggctgcacc ggccagactcctgacgccgctgcagcaggccgcaggcgggttggcgccat tgccgcgtgcataggagatgcaggggctcaaggcagaggtcacctgaccg caggatatcgccgcatcgcaggctacgaggagcatagcggccaccaaggc gaccagcacgagctgagtagctgcaccgcgagccatccctattgagtttg cagtagtagtggtgttgagctcagctggagatggtgagatgggctagatt tgctcggcacgagg
Download
page-top