Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607993
Length 394 bp
Fasta Format > rwhva15e09
tctattgaggngtacatacatacaccaagataagagaaggatgagattat tcctgactgactgactcgcacacactgtttaccctgaatttctcaaggac aagatagcgcaatgaaactaaactggcttactgatgatgacgcgacgacg tacacttgctggaatttttgaagcgatttcaatctctcatggcgatgacg gatggacgagatgagattgaggttttcagtagtcggcggtggggagctgc tcgtgggggcgctggccgatgaagcagatgtcgtagacgagggcggcgat ggcggcgccggcgaaggggccgagccagtagacccagtggttctcccaga cgccgctgacgacagcggggccgaaggagacggcggggttcatg
Download
page-top