Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607992
Length 813 bp
Fasta Format > rwhva15e08
ctcaatatctttatatattaacaaaacatgcccagcaatcgcttggatgc gatgcggtacttaggtacaaaggataaaacatcagatattaaattggcat gcttaaaaggtgtaaaggcagctgccgtcgtcactcctcgccgttgggtc gaagttcttggcagtctggtcggtgcatcctgccggtacaggcaaagtac cttgctgtgcccctttaccgtagaaggtaccagtcttcatcgcatcctgg ttagcatcacccagagctgcctggctcatgtaggtgtcagcaagctgcac acgcttgacattgtcctgctcctggacgagcatgtgcccgtactctagca gcttctccactgtcatctttggctgctcaaaggtcactggtccgtcccgc gagttcaccagcttcttgccaatgttctcgataccggtagaggtcaccca cttgcgcacctcgtcgtcgtacacccgagcacgcagagcaccgaaaaagt cgatggattgtcctgggaaggtgtcgacgatcttgacgacggactcgtcg ctgacattgtcggtctggaagatacccttgcagacaccgatacggtcgtc gcgggtgggagcccagtanaacttctccatacgaccatcacggatcanag gggcgtacaacgtcgagaaatcgttaccagtgacgacgatgggcacacgt gggttctcctccttgttgtacatgcctgggagctgcacattggtgggggc atcngcgatgttcatganggtggcgttcaccatctggttgttgacngngt actgtgtggtccc
Download
page-top