Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607991
Length 299 bp
Fasta Format > rwhva15e07
cgatccttctactattttcagaaaaaaaaaaagagggtcacaaatccatg aaccaggacatgaaagtccacccaanaanaaaaattcaaaatcagcccgt gttctgcatgcccgcggcgattcccttcatggtgaggatgagcgtgtcct ccagcccggggtcgnactcnctgctggggttgagctccatcaggctctcc gccgtctcgtcnatgaactccttggacagcggcggccgcgtcgccggcct gaactcgccgtccctgatcctcttcagcgtgtacgcctgcggcacnagg
Download
page-top