Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607985
Length 910 bp
Fasta Format > rwhva15d22
aatgggaacgaacgaaatgatgaccggccgatgtgagtttacaagcatat tcggctaaatgtttgcgaattcctgattgcattgttccaaagtgaactcg atacgacttgcgaaaacccacatgcctaatatacagcaaaacctacttga atgtgcttgacttaaactgttccaagaagtctctcaaaatgcagcatata caacaccagtggaggacaagcacagctgacaacagggctatccatcggta cttacaaaatgcggtgaacaattttttcttgatccagctcctgagaatgg atcaactcaggaggaatgggatgctaatagtttacccattcccccttctc ccaagctgctgctaggaaggttggatctgaagatcgtcggatttccaaac aacgtccttcaaggtgtttgaaaggttcttgtagaacttgtgaaattcta gagtgtcaccttttgctttgcgaacttcaaccatatgaagagaaggtccg actcgcagtatctcggtagcaacattgaggttccccttccttcctgcttt taccttttctagtctcagcttgtaatttttcttctgaatatcaaatccta gaggctttgcagcttcttcaatcttgcggagaatttctttaggcgagctt ttagatgtaaaccttgtttctcttttaaattcctgctcagagtcgaataa atttccaagattgaggcctgctgacatagaaatcagttcaaatgcattca gagctactggttcttcttctttcttttctgttacatggtgctcttctgaa tcattgaaaaacagcatccacatcatccagtgttgtgtcatacttctcat caaactccgcacgcttgtaaccctttcttgaaccactcatcttctagcat ttcttgaact
Download
page-top