Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607982
Length 916 bp
Fasta Format > rwhva15d17
tttgtccatcaatacaacaggctttcatgtatgaaatggctacacaaatg ttatccaaggagaaatgttattgcgtctctcaatgagataattccttgca caaatctagtcatcggttcaataacgacaagccgccgcacccctggaaca gacaattgatccaacacctcgagcaacgtactcgtgctcaaacaggtatg acactgtctccgcccattcacctgatattgcagctccaaagcattctcca cggtcaattgctcaagttcaatgcaagcgtaaacatcattcttcgccaga gccatgatatcactgtagaaacaggttaatgctgcgtgttaaattgagag gacagggcagttgcaagataatcacatcagctatcctggcgttttctctg cagatagtgatgctttgcatgggtatatcaactccagtttttcaggaaca tcgtatacaaaacatttgaaacagggccaaatgtgaaaaataaaaaggat ataaattagctggtgaacgctatagggtttccggtgacaccaaatttatt agcaaaaagaaaccaagattatgctaaatggaccaaagaagcaaagagtt caaagtttcaactttcaagacacggccagttggccacattacatgcatgg actattgacctcacagccattcatcaatcttaccaaatggaccacacaac tgatgtgcagtgtacaatgaggaatgcaattcacatttaggaatctttta tcctttagcagcttaggatgctgatcagaaaacaagcagaagtgccacca ggacaaacaggataggtctaccaactcctttttctaataacttcactaag ataattaataccacccctcccaaaatccagaatgaacccagtcaacctaa ccagaaatttagtcac
Download
page-top