Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607981
Length 864 bp
Fasta Format > rwhva15d16
tcgatccatgccatatcacagcacttaggaagtcggaaacacacacacac acacatcccgtccaaaattaattacactaggtagcattatcacgcatcga tgccgttacgtacgtgagccttgatcgctatacggccgccggcgacgtgg accgacttgatttggttccaagttacaagcgggacggcatgacgccgaat ttgtcggcctcggtgacgacgtggttgcgggtgatgtcggccagcgagtt gcagccgctcagcgccatggtcagctcgaactcgtcgcgcagcatcttga gcacgttgctcaccccggcctccccggccaccgccagcgagaacaccacc ggccttccgatgaagacgccggcggcgccgagagcgagcgccttgaagac gtcggtgccgcggcgcacaccgccgtccaggaagacggggatctgcccgc cagcacccttcacgacctcttccagggcgctgatggtcgccgggacgtag tccagttgccgggcgccgtggttggacacgatgattccggccgcgccgtt ctcgacggcgagcctgctgtcctctgcggtgatcactcctttcaccagga tcggcatcgtggtgatggactgcagccacttcacatccttccagctcagt gtgcggtcgatttggccggcgacatatgaagctagtcctgaatcgttagc ctggtccattttcccgaggtccaaaccttcaaagttcttgagtgtcaaat ttggtggcaaaacaaatctgttcttgatatcancttccctgcggccaant cncggggtgtccacggtgancgctatcgccttgaatccanccttttccgc tctcctcanaanct
Download
page-top