Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607972
Length 669 bp
Fasta Format > rwhva15c24
atacatagccaccgtattgcattcacatacgagcacgctttctcgagcca tgttgttacatgaacatggacatacacatattcttaggaacaagtaagaa agacaaatggagaaggaaaacccaaagcaatgtcagagttgacaaaactg caatggcactttatatgtggcccgtggtgagtgagctgtttaggccttgc cggactcctcgcagcccggtggcttgaaggcaatgaagctgacgcactgc acctggcgcatgttgtcgaatccgatgatgcggacgtacgcgtcagggta ctccttcttgacctcctccacctcgttgatcacctgtgtggcgtcggtgc acccgaacataggcagcttccacattgtccagtagcggccgtcgtagtac ccgggagacgcattgtgctcacggaagatgaacccgaccttgctgaactc aaggcaaggcacccacttggagcggatcaggtagtccacctgcttgagga gggcctccgtgctgagcggtggcaggtaagacagggtctcgaacttcttg atgccctcgatgggccacacctgcatgcacctgatccttccaccgttgct gacgctgccgaggctagcgccgttggagcggcggctgacggggaggccgg cggtggacttgagcccctg
Download
page-top