Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607971
Length 860 bp
Fasta Format > rwhva15c22
ttattgggagccaacaattacaggtaggtatcatcatattatgtagtaaa tggaccgaatatttccgcatatatcttcccccctatacatatcaagcata gcaaccagttttcttcaccatagttacagcttacagctaattaatcaact tcaattgctggtagaaaagagcagcattgtattatatgtagatgcggttg tcttcttctctcttcacagcctcgagtggtcctggtattgctccatgaac gagtcgttgaacttcttgaagctcgacatgatcgccggcatgtcctcctc cgcgggcaggatcgtcgtcctcagatggaacaccccttctttctgaccaa aacctgagcctggaacagtggatattccagtggcttccagaagcttgagg cagtagtaaacatcgggcgctttgccagcgctttttgctacatccatagc tctttgcggcagccgtatttgcgggaaagaatacatagctccttctgtga aattgcagacaacatttcggcaactattgaaaccgtctgtcattatttgt gccctcctcctcaaagattcaaggatagacttactttcagcagaatactt caggtacgagatgtctccaggtttaggagggttcaccataagtcccatga agatctgcccaggaacatttggactcagcgcgattgatgcaaccttgtaa atctcgtcgacagtcttgggaggtatgtttgtcatttcaaagtacccacc acgttgtccacactctccccaatatcctttggacacagtatggaaaagaa atcagctgaacttccctgcttactggaggaacccatgtcaaacataacct ttcttgcact
Download
page-top