Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607968
Length 605 bp
Fasta Format > rwhva15c18
tctatttatctaaccatgagtgggtctgatggtacaaaagaagttcatct gccgaagagtttggaaaagaagtttgttggtttcgagttctctgcgcacg ccacatgcatatatcttcctagattgtcaacttgccttggctcccctctt gtgtctttcttgcaaactttgcaggtcttgtccacccaaccttcctccac gtattcgccgtcaacttcaacatatgacttgaagaaatccttgtaggtgc caccaatcttcctccgaagggctgcatactgttcccttgtcatccttcct tcatctttgatggaatccctggcctcatacagcagctccgcgtccttctc cgaccggacctgcgagaagtccagcgcctcggtgatgttcccaaacaagg actgcttgggcaccttcttcttctcctcctcctgctcatctgctttcgca taggccctaactgatctagcaggactggcgctgcctggcttgaaggaggg catgctctggtggagcccaaacgaggagctctgggccggggacagcgcga gcgccctcatggccatggctttgatcagctggtagttggttctccttcac cgcag
Download
page-top