Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607959
Length 502 bp
Fasta Format > rwhva15b23
gtaacatcgtgcaaaccgccatgactctctcaacaacaatatcttggagt tttcaaaggtcacggcggcatcatctgtgcgtggtcatcaagcgacggtg ttggccggggtcacctccggtgcaggcgcggcgtctgctgccggggttgc ctcaggtgcaggcacggcgtcggctgccggggtagcctccggtacaggag tggcttcggcctcccagaaggcggtcttcttcccggtcttggagaccgtc tggaaaacgtcttctggcttgacgttgcccttcacggtcaccttctgctg ctccatgtctatgtcgaagctctcgacgccttccattttggtgagcaccc ttttaaccgcccccgagcaacctccgcaggacattgccaccttgaggaca acagtctcggaggccatggctggcagctacagcaggagtcaggaggagaa gatcgggagacggggatcgatgtcgtcggagggagagtttgatgatgcct gc
Download
page-top