Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607958
Length 575 bp
Fasta Format > rwhva15b22
gtacttgtcattacacatacaagcacaacagctccgttattctgcagcgt agatagcgagagacgcatgcatgtttttatccaggacagaccacaactcc acatcgtttcttcagtagatacgtacgcacgcatgggtaggtatgggtat gtgtatgtcgatctgcacgcgtacgtgcacgagccatgcatgatgcatgc acggcgcgcgctggctggctcagtagtacggctggagcttccagcgttgg ttgtcgccctcgcaccacttccagagcacgacctcggtgccgtcgcgcac gccgccgtggtacttgtcgccgttgagggcgtcgaagttgaggtagatgt tgttcaccatgcgcacacacctgaagccgttgcccacgtncctgctctcc gtccacancaccgactcntccangtagtctgggttgtacggcaccagacg cacagggtgggactggccgagggagtgcttgatggcctgcccggtggcct tgttcaccatggcgaaggcngggtacccctcctcatccttnatgctggng ntccacctcntgtccttgatccaat
Download
page-top