Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607953
Length 775 bp
Fasta Format > rwhva15b15
tataatattatgcgtccgtgcatatacatagcccaccgatagcattcaca tacgagcatgctttctcgagccatgttcgtacatgaacatggacatacac atattcttaggaacaaataagaaagataaatggagaaggaaaacccaaag caatgtcagagttgacaaaactgcaatggcactttatatatggcctgtcg tgagtgagctgtttaggccttgccggactcctcgcagcccggtggcttga aggcgatgaagctgacgcactgcacctgacgcatgttgtcgaatccgatg atgcggacataggcgtcagggtactccttcttgacctcctccacctcgtt gatcacctgcgtggcgtcggtgcatccgaacataggcagcttccacattg tccagtaccggccatcgtagtacccaggggatgcgttgtgctcacggaag atgaacccaaccttgctgaactcgaggcaaggcacccacttggagcggat caggtagtcgacctgcttaaggagggcctccgtgctgagcggtggcaagt aggacagggtctcgaacttcttgatgccctcgatgggccacacctgcatg cacctgatccttccaccgttgctgacgctgccgaggctagcgccgttgga gcggcggctgacggggaggccggcggtggacttgagcccctggaaaggag cgacggaggtggccgacgaggccatcacggtgggggccatggctgtacta tgtaggtatatagcttgctaggagg
Download
page-top