Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607952
Length 756 bp
Fasta Format > rwhva15b14
atacatagccaccgtattgcattcacatacgagcatgctttctcgagaca tgttggtacatgaacatggacatacacatattcttaggaacaaacaagaa agataaatggagaaggaaaacccaaagcaatgtcagagttgacaaaaccg caatggcactttatatgtggcccgtggtgagtgagctgtttaggccttgc cggactcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgc acctggcgcatgttgtcgaatccgatgatgcggacgtacgcgtcagggta ctccttcttgacctcttccacctcgttgatcacctgtgtggcgtcggtgc acccgaacataggcagcttccacattgtccagtaccggccatcgtagtac ccaggggatgcgttgtgctcacggaagatgaacccaaccttgctgaactc gaggcaaggcacccatttggagcggatcaggtagtcgacctgcttgagga gggcctccgtgctgagcggtggcaggtaggacagggtctcgaacttcttg atgccctcgatgggccacacctgcatgcacctgatccttccaccgttgct gacgctgccgaggctagcgccgttggagcggcggctgacggggaggccgg cggtggacttgagcccctggaaaggagcgacggaggtggccgacgaggcc atcacggtgggggccatggctgtgctatgtangtatatagcttgctanga ggaggc
Download
page-top