Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607951
Length 770 bp
Fasta Format > rwhva15b13
gtgcatatacatagcccaccgattgcattcacatacgagcatgctttctc gagacatgttggtacatgaacatggacatacacatattcttaggaacaaa caagaaagataaatggagaaggaaaacccaaagcaatgtcagagttgaca aaaccgcaatggcactttatatgtggcccgtggtgagtgagctgtttagg ccttgccggactcctcgcagcccggtggcttgaaggcgatgaagctgacg cactgcacctggcgcatgttgtcgaatccgatgatgcggacgtacgcgtc agggtactccttcttgacctcttccacctcgttgatcacctgtgtggcgt cggtgcacccgaacataggcagcttccacattgtccagtaccggccatcg tagtacccaggggatgcgttgtgctcacggaagatgaacccaaccttgct gaactcgaggcaaggcacccatttggagcggatcaggtagtcgacctgct tgaggagggcctccgtgctgagcggtggcaggtaggacagggtctcgaac ttcttgatgccctcgatgggccacacctgcatgcacctgatccttccacc gttgctgacgctgccgaggctagcgccgttggagcggcggctgacgggga ggccggcggtggacttgagcccctggaaaggagcgacggaggtggccgac gaggccatcacggtgggggccatggctgtgctatgtangtatatagcttg ctaggaggaggcactctggc
Download
page-top