Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607948
Length 429 bp
Fasta Format > rwhva15b09
aaccataaatacaaaggaatattgtttacatctatgattgcctcttgggc atatatatgtttctaacaacactatatgccgctgtactacaaataataat aataacatgtggcgtggagcacaaaactatgctcaaggggaagaaggtca caagacagaacaatagttccttgttctttcccaggtcgcaacaatattac tacatcaatgcttcgtgctgcccctagcaaagtgtggtccgaaggtgcac ataagaccgatgacggtggccgcgttaagcatgaaaaacacaaggtggtc gcctggaagaaatgaagcagtttggcgcctttgagcccatgaaaatataa cacctgcaacagccggagcgacagctttgaagatggacattagtgttaca gaaagcctcgtgccgaattcggcacgagg
Download
page-top