Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607947
Length 747 bp
Fasta Format > rwhva15b08
tatattatgtgcatgtgcatatacatagccatcggtagcattcacatacg agcatgctttctcgagtcatgtcgggaacatggacatacacatattctta tcttaggaacaaacaagaaagataaatggaaaaggaaaacccaaagcaat gtcagagttgacaaaaccgcaatggcactttatatgtggcccgtggtgag tgagctgtttaggccttgccggactcctcgcagcccggtggcttgaaggc gatgaagctgacgcactgcacctggcgcatgttgtcgaatccgatgatgc ggacatacgcgtcagggtactccttcttgacctcctccacctcgttgatc acctgcgtggcgtcggtgcacccgaacataggcagcttccacattgtcca gtaccggccatcgtagtacccaggggatgcgttgtgctcacggaagataa acccaaccttgctgaactcgaggcaaggcacccacttggagcggatcagg tagtcgacctgcttgaggagggcctccgtgctgagcggtggcaggtagga cagggtctcgaacttcttaatgccctcgatgggccacacctgcatgcacc tgatccttccaccgttgctgacgctgccgaggctagcgccgttggagcgg cggctgacggggaggccggcggtggacttgagcccctggaaaggagcgac ggaggtggccgacgaggccatcacggtgggggccatggctgtactat
Download
page-top