Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607944
Length 845 bp
Fasta Format > rwhva15b01
agtttattacaaagccaagtgccacccggcagataaactaaaacgtaaac agatactccctccatcccaaaatacttgtcggagaaatggataaaattgg atgtatctataactaaaatacgtctagattcattcatttccccgacaagt attttcggacggaggaagtatcataaaccaaccaaagatacatactcttc aaatactaccacataagtgaccacagtccagtggagtaacaaaaatgttt gctgatcatccactacatcgaataatcgatgcataaatacatccactgct aattccaggttgtcactctgcacggtctcttttgtccttgtagacgtagg atctggcgaaatagatgtggagcacaagctcggtggcgctgaggccggcg agaacccagtagaagtagtcgaggtgggcgcgattgaggttatcagaaaa ccagctgtcgccatcaccgctacgggtgatgcggtcaatgagtgaaatga gagcgccacttatgaagccaccgacgccaatcacactgcagtagagcgct atcccaaggctacgaagctctttaggcatctggtcatagaagaactcctg catcccgactatcacaaacacatctgccaccccgaccatcatgtactgtg gcactagccatgcccagctcatcggcaccgtcgcaccaccatcgtcaacc agttcatgttgtcgtgccgtctctagcctccgagcttccaccaacgccgc cacacacatggcagctagcgacacagccatgcccgtgccctattcgttgc aggagcgttagtcctgatgggatgcctgtcacgcacacaatgctg
Download
page-top