Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607943
Length 661 bp
Fasta Format > rwhva15a23
acatatagcagattacatgcacttatagaatatgaatattacaaagcttc ttacttctcaaattacagagtattcagagagagaaagggagagaaggcag cagcaaaaaggtgtaggagaagagaagcagcagcagaggcatgggcaaga agagagcagcagcaggagaagaagcagagcaagggaaggagcagcagcaa gacggaggagaggagcagcagcaggaagttgaggagaagaagcatcagcg tgggggcttggagaaggagcagaacaacagcgaggtaggggaaagtagaa gagcagcagcagtagggattcagagaggaagcgagcttggagaaggatag cagcggggagagttgtagacgagcagcagcaggggcacggggaagaagga gcagcagacagggattcagagaagcggggaagaagggaagaagaagcagc gcggtgtgtctggccgggcgcgccggctggagggagatgtcgcgcgaggt gggcactggtggctggcgctgtgatggatagatgatggtgtgggtggtgg atggcgcgggtgatggtggagcgaggtcncgnaggcgcnccgccacnatg gcctgnccgcngcgtcnncccnatgtggnanaancctcntgccnaattcc tgcnncccnng
Download
page-top