Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607941
Length 886 bp
Fasta Format > rwhva15a20
tcataacacactacatancgtatggacagctgngccatggtcatcaaaca ggtgacaagccatgtaatccatgtaacgttggccttcccgaagtaaaatg aagcacattggaccccaaaaatcacaacaccgaacccgctccgctgctac acacaacccaccatcaaccgagcaaaaaggacgctaatatacacctactg gttgaaggtccgctggcatgtagcagctgcgaatagtcgtcgaatcaaca catgcacaaggtggaaggaagatggatgcagtaagcaaacagcaatacaa taacaaataatggcgggtggggctttcacttgatcacttcattgtttccc ctgacggcatgaccggccgctccagcttggacgttcctccttgagcacct caagcagtcaaaggaggtgatgatgcacggtgggcggacttctcgagtac cttacacgggcgaagatggtcctcatagtaatgtttagaagagctcttca gagttaaatttgttccaggcctccttaagaagatcaaaaaccttctcggc gatatatttctgctgtagatttgcacccttttgttgcaccttatcaggat ggatgcacaaagttgcctttctgtacacctttttaaccgcagcagcagtg atcagatctgttagggatacaggctgccatccacattctggccaaagtac atattgcatagttgatagcagtgcccgcaaattgccttcttttccagcag cccatcgcttaatctcgaagtctagactttccgaaattctatctctttct gcctgctctctttgaacattcatgtcccgttcattcttctcagccagggc ttttgccgctcgttcacggggtccgtttgatgccgc
Download
page-top