Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607940
Length 858 bp
Fasta Format > rwhva15a19
ttagtatatgcagagaaagctaacagcataagcagaaaacactagcttca atggaaacaactgaaaaacactacgttcaaattacatccaacaaaatgga attgactaattgagtgagacaagctcaacctacaaagttggcatcatttt gcctgctagctcactcgccacctctttctgtcctaaatcaacccattcac agagctattcgaagggagcatcatccatcaatgtgcactgacaccattct ctgcgttgagcccatacagcacgcctgcatatttctcggttgatccagca aagaaggaatccttgagtttccagaacgcacaagacgtgaccaggctatc ggacccggcctgatgtgactctccaacacgctccacatcgagcaactcgg cgagcttgttcagcccgccgtgcaggctgttgcagaacttcatgagatgc ttgatgtcatagacggtggggaaatatatcttcatcagcttgaagaaccc agcctgtgtgtctgggaggctgttacaggtgaggattttgagcaggtagc cgaagtcgtatcccgcgtggaaggtcacccagtagacggcgtcattgagc acaacgcccgaggacatgagcagctccgcaaatcggcgggcgtcgacgcc tcgctcggcgttgcggcggaagtcgatgccgctgtggcggagcagctcga tggagtcggtggcgaagatgtcgcgctcgtcgtcgaactcccggaagttg aactgccagacgcatcggcggcgtccggcgccgagggcagggagctcgcc cgtggggcccgagaaggtgagccccanctggatgangtgcagcatgtcga cnttggcc
Download
page-top