Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607936
Length 263 bp
Fasta Format > rwhva15a14
tcagcaacagccgaacatcgggaagagaagcaggaaggcgaattctcctg gacacgccgcggtaggagaaagtggactatagcgatcaatgagagcacgt atcttaaggccaagccatgctcccctcaaaaaaaaaaaaaanaggcaaan ccatgctcnatcaaagctgnggaaacncctcanaatcttcagttttacaa ttatgcttaagggaggaaatgttcttggngggcggccgtcaattanttcn cttgctttgctta
Download
page-top