Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ607935
Length 356 bp
Fasta Format > rwhva15a13
gagcttgtaaagtgtgcaatcgattgtgccntcatcgaagcngacctttt gcacaaccatatgcacantaatagggggcgattannagatcggcacaacg ctgtcgnggaccctgttcttctggttctgggcaacgcattccgagatcca catcaagttccttatctcctgctctcgtagcctcatgtatgcgaanaana cagcgtantgnaactgctgttcaaatgactggcacagcctctttacttcc tcctcntaaaaggccttgnccaacatctggctttcgccatatgatatctt ggcaaaaatanactggtatggggggtacttttccattacnccacnnnacc tggtca
Download
page-top