Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715667
Length 662 bp
Fasta Format > whva9d05
ccggcaccgcgaaccagtgcccgaccatcgacggcggcgtcgactccttc cccttcaaggccggcaagtacgagatgaagaagttctgcctggagcccac ctccttcaccgtcaaggccgagggcatccagaagaacgagccgccggcct tccagaagaccaagctcatgacccgtctcacctacacccttgacgagatg gaaggcccgctcgaggtcggcgccgacggcaccctcaagttcgaggagaa ggacggcatcgactacgcggccgtcaccgtgcagctccccggaggcgagc gcgtgcccttcctcttcaccgtcaagcagctcgtcgccaccggcaagccc gagagcttcagcgggcccttcctcgtgcccagctacaggggttcgtcttt cctcgacccaaagggccgtggtggctctactggctacgacaacgccgtgg cgctacccgccggaggcagaggagacgaggaggagttggccaaggagaac gtgaagaacgcgtcctcctccacgggcaacatcacgctcagcgtcaccaa gagcaagccggagaccggcgaggtgatcggcgtcttcgagagcgtgcagc cgtcagacaccgacctcggcgccaaggcgcccaaggatgtcaagatccan ggtgtgtggtac
Download
page-top