Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715392
Length 312 bp
Fasta Format > whva7k02
tgagagcacgtaagatccccttcacgattaggcgctacttacctgatgga agctacgaggactggggagttgacgagctcattgtggaggactcgtggaa gcgtcaggttggcggggactacagctggtanactgttcgaatgggaggct ccgtgctgcaactaaactttgccctagtagctatatgcaatctttggcac tgaactgccgcgacaatgttatgttaccgtaacatgtgtgggctatgtct gcccattgtgttgngctactactgtaaaccaattgcgtggttgcgttagn ttgcttggacca
Download
page-top