Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715222
Length 690 bp
Fasta Format > whva6h23
acgagggcctctcccaaaccctcccgccgccgccgccgccgcccgccacc gaacagcagccatgccgcccaagctcgacccgtcgcaggtggtggaggtc tacgtccgggtgaccggaggcgaggtcggcgcggcgtcttcgcttgcccc caagatcggccccctcggtctctcccccaagaagatcggtgaggacatcg ccaaggagacggccaaggactggaagggcctccgcgtcaccgtcaagctc accgtccagaaccgtcaggccaaggtctccgtcgtcccttccgccgcggc gctcgtcatcaagtccctcaaggagcccgagagggacaggaagaaggtga agaacatcaagcacaacggcaacatcagcctcgacgacgtcatcgagatc gccaagatcatgaagcccaggtccatggccaaggagatggccgggactgt caaggagatcctcggcacctgcgtcagcgtcggctgcaccgtcgacggga aggaccccaaggacctgcagacggagatcgacgacggcgaggtcgagatc ccctccgcttaaaggctgatgtcgaggtgattatcatctgatgatatgga agtcataccctgttgcaaatgttgcctatgtacctcccaaacgatgtgat ccctcctctttttgtcatgttttagcagtaatcctgtgag
Download
page-top