Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715196
Length 682 bp
Fasta Format > whva6g07
actcttagtantagtaccaccaccacttgtagaatagccgccatatcgaa ggcgctgtaatcgccaagaaaaataagacaagttcaacaatggcatgtca tggacaagaggatgtggaacaccttcaaaatgctaaggacacatattggc aaagctcaagactcttcatttatattttagtgatccaagatcacattgag tccataggaaagccaatactattaaaaggggatgaggtgttgcttaatgg tctacttgctcaaaatgcttagtgatattgctccaaagccctcaatcact ttcccattttcaaatatgtccaaaacacaaagtcaaactcggccccaccg aaatctcctatccggcgccaccgagtttatttgacatagccactgccaga aaccctaacacctcggtcacaccgatacggatctcggtctcactgagatg gccttgcaaactctctgtttccctttttataacatttcagtctcaccgaa atgagcgatcggtcacaccgagtttgcttgatctactctctgtttgctct ttgctgaaattggtctcaccgagttcacgcaatcggcgccaccgagatga ngttttgccctanccctagcacatcggtcccancgagttcttccagtcgg tccaccgangattcctaacgttcacattttga
Download
page-top