Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715191
Length 619 bp
Fasta Format > whva6f20
gtgctacagccgttgaggaagccggtggccccaaaatccccatgatctat ggaagggttgatgtttctgcccctgaacagtgcccaccagaggggagact ccctgctgctggtccgccttcacctgctgaacatttgcgagaagtattct acagaatgggcctgaatgacaaggaaattgttgcattgtcaggagcacac acacttggacgatcaagaccagagcgcagcggctggggtaaacctgaaac aaaatacactaaaaatggacctggtgcacctgggggtcaatcttggacat cacagtggctcaagtttgataacagctatttcaagcatgtcaaagaacga cgagacgaggaccttctagttctgcccactgatgctgtgctctttgagga tccatcattcaagatttatgccgaaaagtatgctgaggatcaggatacat tttttgaagactacgctgaagctcatgctaaattgagcaatcttgggtct aagtttgaccctcctaagggtgtatcactagactagctgatatttgctgc tgatgaactgcattttggtgagtgaagatgacaaggctatgtttcttgca actattttcgaggtgaaca
Download
page-top