Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715149
Length 587 bp
Fasta Format > whva6c16
cggcacgangggcgccaacatggccatcaccggcgccaccgccatggacg cccccttcttccgctccctcggcctctccgacaagatctggaacaacggg cccatcagcttccagctccagtggttccagaccatcacctcctccgtctg cggcagcagctgcaagagctacctggcgaactcgctcttcatcttcgggg agttcggggggaacgactacaacgcgatgctgttcggcaactacaacacg gaccaggcgagcacgtacgcgccgcagatcgtggacaccatcggcgccgg cgtggagaagctggtcgcgatgggggcggtggacgtggtggtgcccgggg tgctccccatcggctgcttccccatctacctcaccatctacggcacctcc agcgccgccgactacgacgccctcggctgcctcaagaagttcaacgacct ctccacgtaccacaacagcctgctgcaggccaaggtcacgagcctccaag gccaagtacaagtcggcgcgcatcatgtacgctgacttctacgccggcgt ctacgacatggtccggagccccagcaaaatacgggtt
Download
page-top