Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715119
Length 705 bp
Fasta Format > whva6a16
acaaattagtacgtaccaacactccatcaacttcaaaaatgtctggttgg tttcaagagaagtccggcgacgccaccaagacggcgtccgagacggggca gaccattcaagaccgcgccgtcgaggcaaaagaccagaccggggccttcc ttggtgagaaaagcgaggctgtcacgaaggctgcctccgagactaccgag gcggctaaaaagatgggcggcgaggccatggggaaggcgtccgagacggt ggaagccggtaaggatcacgccgtcgagggcaaagaccagacaggcagct ttttcggcgacaagactgacgctgtcaagaagacggccaccgagactgcc gatgccaccaaggagaagtccaccgaggccgcccagcatgtccaggacac cgctgcacagtacaccaaggataccccggtcgcccccaaggaaaacgtct tccagcaggccggcgggaatatggtgggtgccgctacagacgccaaggac gctgtcatgaacacgctcgggatgggaggagacaagtgagatgcgggtgg tgccaccaagaagaccacaaaggataataggcgcgtctgcgcttgcttgc cctagccctccttctgtttcgctattccttcaatataatttaatttccag ttccatggcactaatttacacatgctccttggtgtaactttgtatgatgt atccg
Download
page-top