Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715087
Length 563 bp
Fasta Format > whva5n19
atcgaatggttcacaaaggcagggttcaaggatgttcagctgaagaggat tggaccaaaatggtaccgtggtgtccgtaggcatggcctgatcatggggt gctctgtgacgggcgtcaagagagaaagcggggactcccctttacagctt ggtccgaaggctgaagacgtcagcaagcccgtgaatcctatcaccttttt cttccgcttcctcatgggaacaatatgtgccgcgtactatgttctggtgc ctatttacatgtggataaaggaccagattgtgcccaaaggcatgccgatc taagggaggggaattgagctgcagcgaagagaggatagccaatatctgaa ttaggcttctctatattaggcacttcacatctgtttttgtttacctttta tatttcctgttgtcgtgtatttactttactttgggtcttgttatgtggag aaataatatttatgacttggattaaacgcgtcagagctcttgagcgtgaa atggctcatttgtaccangtcattgtttcacaaatagaatgtatctgnaa tatttctccccct
Download
page-top