Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ715043
Length 719 bp
Fasta Format > whva5k04
atctttcctttttctgctgtactcaagaagctggatttgctgtacagttt cctcaccactgaagatcattgccagctcattgcaaaatgtccaaacctac tcgttcttgcggtgaggaatgtgattggagatagaggattgggggttgtc ggagacacatgcaagaagctacaaaggctcagagttgagcgaggggaaga tgatcctggcatgcaagaagaggaaggcggagtttcccaagtaggactaa cagcgatagccgtaggctgccgtgaactggaaaacatagctgcctatgtg tctgatatcacaaatggagccctggagtccatcggaacgttctgcaaaaa cctccatgactttcgccttgtcctgcttgacagacaagagacgataacag aattgccgctggacagcggtgcacgcgcgctgctgaggggctgcaccaag cttcggaggttcgctctgtacctgagaccaggggggctttcagatgtagg cctcggctacatcgggcagcacagcggcaccatccagtacatgcttctgg gtaacgtcgggcagacggatggtggactgatcagtttcgcagccgggtgc tggaacctgcggaagcttgaactgaggagctgctgcttcagcgagcgggc tctggccctcgccatacggcaaatgccttccctgaggtacgtgtgggttg cagggctacagggcctctc
Download
page-top