Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ714983
Length 626 bp
Fasta Format > whva5f10
acggtgccttcctcgaaaccacggtctgtcgttgatcctcatgacttgaa gggttacatgatgggctttgacccaaagaccttggagttgtgcgcgaagc tgcgcacaaacgaggcttgtaatctcattgagaagcacagctgggcactc tttggagaaaagatgggctccacggagattgacgaggcggtgatacttga tccggcatcccttaaaaggctgctgcttgaagccattgcatttggttcct tcctttgggatactgaagactatgttgatgagatatacaagttgcaggac agctgaaaatggatctccagaagattcgtgaagcactggagatacggagc tcgctggaagaagagtttgcagaagattcctgggaccttgtatatacttt aggaaaatacccttttcttctgtgcatgtaaatcttgaccttgcaggtgc taaattatttagtagcttttttttttctgaaataanaaccttgcaggcac taaaagaataatctacttatgaccttgttgtatanatggngccagtaagc atatgtccatttaggcattcgcttgcattctgtaatctgtaatacagtgt agtgatgcactcatgcatcttcagat
Download
page-top