Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ714832
Length 517 bp
Fasta Format > whva4k13
ccaagcacatagtaacatcgaccgatcggcatggcgcacttccaggaggt ggactactgctcggaggaggtgagggcggtgggcaacccggcccgccgcg gcggcggcgtgcaggagcacatcgtcaaggagacgttcgtgcaggagttc gacacctccggccgccgccacggtcaccacggtcaccacggccgcggctc tggtcacttcgaggtgcgcgagagcaggctcgaggaggacttcaacaccc gcaccggggagttccacgagcgcaaggagaacttcgtcgtcagggccgat gactgagcttacacgtaacggagcacactacgatgtgtgtatatgtatgc atgtcagcagtatatgtatgtgtgatgttgcgcacagtcgtatagcgtat gcaggcgtgcgtgcttggcggccatcagcccctatcgcgcgcccgtgcag cgcttaaataagcgctaatcgtgaaccagaataaagcttctcgtgattag tagtattaaaaaaaaaa
Download
page-top