Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ714747
Length 687 bp
Fasta Format > whva4e11
attcggcacgaggagtcaatggaactgttgcccatgaattcatcattgat ttaagagggttcaaggcaactgctggtattgagcctgaggatgtggcgaa gcgcttgatggactacggattccatggaccaaccatgtcatggcccgttc caggcacacttatgattgaacccactgaaagtgaaagcaaggctgaacta gacaggttctgtgatgcccttatctccatcagagaggaaattgcagaggt agaaaatggcaaagcagatgcgcacaacaatgtcctgaagggcgctcctc acccaccccaactcctgatgggcgatgcatggactaagccatactctagg gagtatgctgcgttccccgcggcgtggcttcggggtgccaagttctggcc aacaacatgtcgtgtggacaacgtgtacggggatcgcaacctgatctgca ctctgcagcaggcgtcccaggtggcagaggaagctgcagctgccaccgcg taatcttctgatgatgacgatcctggtgtgtgaaacagtgtcaagaagtt atcatgcttcctgtangagggaagcatgcttgcttctaaatccctcatgt actgtatatattctcctcaaatgccaccttctcatgtatcctctgtaccc ccccactgccctccccattcccatttgaaagtgaaat
Download
page-top