Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ714679
Length 613 bp
Fasta Format > whva3p07
atggctctgaggctgtgggcgagctcagctgccaatgccctcaagatttc aagcagcggcgccagggctgctgccccggcctattcgatctccagatact tctccactgttattgatggcttgaagtacacttcctcccacgagtgggtc aagaacgacggctccgtggccacgattggcatcagtgaccacgcccaggg ccatctcggggaggtggtgttcgtggagctgccggaggccggcacgaagg tgagccagggcggagccttcggcaacgtggagagtgtgaaggccaccagc gacgtcaactcgcccatctccggcgaggtcgtcgaggtcaactcaaagct gtccgagacccccggccttatcaactcgagcccgtacgaggaggggtgga tgatcaaggtgaagccgagcagcccggcggagctggagggcctgctggac tcggccaagtacaccaagcactgcgaggaggaggacgcccactagtgctc cttgctcgattatcgttccttttttgttgcaaccatgtcnactactcttg tctacaataattaaaccagcttcaccatgcgttcagttcatcggttccag ttttcttttgtcg
Download
page-top