Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ714572
Length 653 bp
Fasta Format > whva3h18
ggcctcgtgccgagaagattccagaaatggctgtcgccgtagctgccggg accctccgtacctgttccggcgtatttccggcggcgtccgggaaccatcc gcttgccgggtggcggccacttgcaccggcagcgcccgctaagctgagat tattgtctccagctttgagggttcctagagctgcttcgcctgcagctgtt gagaatgggagctctagcaacagtaatacagtccctacaccgaaggttat aatagatcaagactcagatccggatgcaactattgtggaagtaaccttgg gtgaccgtcttggggatcttcttgatactatgagtgccttgaggaattta gggctaaatgttgtgaaagctagtgtttgcctcgattcttctggcaagca caataagttcgctataacaaagtcgtcaactggtcgcaaaattgatgacc cagagttgttagaagcagtaagactgacaattattaacaacatgcttgag tatcatcctgaagctagcagtcaattggccatgggtgcaacttttgggct agagccccctacggaagtggttgatgtggacatagcaactcacatagaga tctatgacgatggtcctgaaagaagtttacttgttgtggaatcagctgac cgt
Download
page-top