Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ713799
Length 739 bp
Fasta Format > whva1b24
cgaggagcaaatctagctaattacccaccctctccctgcgagccctccac cacaactacagctaactcggtcgagatggctcgcactgcagcaacaaagc tcgtgctggtcgccctggtggcggcaatgctcctggtagcctccgacgcg gcgatctcctgcggtcaggtgaactctgccctggcctcctgcgtctccta cgcaaaaggcagcggggccagcccgcctggggcctgctgttccggagtta ggagattggccggcttagcgcggagcaccgccgacaagcaagcggcatgc aggtgcatcaagagtgctgccggtgggctcaaccccggaaaggctgcaag tatcccctccaagtgcggcgtcagcatcccctactccatcagcgcatccg tggactgctctaagatccactgatcgattacttgccgccatcatcgccga ttatagctccagcgatagatgccgagtacgttgaggtcacacacacacat atatatatatatatatacacatatacatgaataaatgctctgatatgatc tccatgtgagagacangagtacgtacgtcgagccagctctgcatagccgg ccactgttgtatctattttgtatcagcgtttgattgttcgntcactccct ttgagcagagacgggagtttgttgtactttgtaccatgtgcactcatggt attataaattaatctagctctattcagttaaaaaaaaaa
Download
page-top