Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ713507
Length 666 bp
Fasta Format > whva18o07
ttgatggactacggattccatggaccaaccatgtcatggcccgttccagg cacacttatgattgaacccactgaaagtgaaagcaaggctgaactagaca ggttctgtgatgcccttatctccatcagagaggaaattgcagaggtagaa aatggcaaagcagatgcgcacaacaatgtcctgaagggcgctcctcaccc accccaactcctgatgggcgatgcatggactaagccatactctagggagt atgctgcgttccccgcggcgtggcttcggggtgccaagttctggccaaca acatgtcgtgtggacaacgtgtacggggatcgcaacctgatctgcactct gcagcaggcgtcccaggtggcagaggaagctgcagctgccaccgcgtaat cttctgatgatgacgatcctggtgtgtgaaacagtgtcaagaagttatca tgcttcctgtaggagggaagcatgcttgcttctaaatccctcatgtactg tatatattctcctcaaatgccaccttctcatgtatcctctgtaccccccc actgcctccccattcccatttgaaagtgaaattagctatattggctagca tttccactcttctctgaatacaggacaaataatggagatctgttttgatg tcctagccatacacgg
Download
page-top