Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ713502
Length 652 bp
Fasta Format > whva18n20
gctcctccgttacctgcataagttgcaatccaaggatctctcactgtgcc acagtatgatccctcttggttcttgcaccatgaaactaaatgctaccgtc gagatgatgcctgtcaccgatcccaagttcgccaacatgcacccatttgc ccctattgatcaagctgcaggctatcatgaaatgtttgacaacctgggcg atctgttgaacaccatcactggttttgattcnttctctttgcaaccgaat gctggtgcttcaggagagtatgctggactgatggttattcntgcctacca caaggcaagaggagaccaccaccgaaatgtctgcatcattcctgtctctg cgcacggtacaaaccctgcaagtgctgctatgtgtggaatgaagattgtt gccgtcggaactgatgccaaaggtaacattaacattgaggagttgaggaa agctgctgaagcaaacaaggacaacctgtctgctctgatggttacctatc cttcaacccatggagtctacgaagaaggcattgatgagatatgcaggatt attcatgagaacggcggtcaggtctatatggatggagctaacatgaacgc tcaggttgggttgacaagccctggttttattggagcagatgtttgccatc tt
Download
page-top