Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ713486
Length 752 bp
Fasta Format > whva18m20
acctcccgtttccacctctctatcctatggatagagccgccgcgacagcc atagatatcctcgctatgatcccatcagcgccctctcctttgtagcacca tctcccctcccccaccccacccccgggtttatttgacaagatttgatccc aatcctcgcacgtttcttggccgagtgggggagaagattccagaaatggc tgtcgccgtagctgccgggaccctccgtacctgttccggcgtatttccgg cggcgtccgggaaccatccgcttgccgggtggcggccacttgcaccggca gcgcccgctaagctgagattattgtctccagctttgagggttcctagagc tgcttcgcctgcagctgttgagaatgggagctctagcaacagtaatacag tccctacaccgaaggttataatagatcaagactcagatccggatgcaact attgtggaagtaaccttgggtgaccgtcttggggatcttcttgatactat gagtgccttgaggaatttagggctaaatgttgtgaaagctagtgtttgcc tcgattcttctggcaagcacaataagttcgctataacaaagtcgtcaact ggtcgcaaaattgatgacccagagttgttagaagcagtaagactgacaat tattaacaacatgcttgagtatcatcctgaagctagcagtcaattggcca tgggtgcaacttttgggctagagccccctacggaagtggttgatgtggac at
Download
page-top