Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ713038
Length 707 bp
Fasta Format > whva16m12
ggcccccgccgtgatggcttcctcggctaccaccgntcgcacccttccag gggctcaagtccacagccggtctccccgtcggccgccgctccagcggcag cctcagcagcgtcagcaatggcggaaggatcaggtgcatgcaggtgtggc caattgagggcatcaagaagttcgagaccctgtcttacctgccaccccta tccacggaggccctcctgaaacaggtcgactacctgatccgctcaaagtg ggtgccctgcctcgagttcagcaaggttggcttcgtcttccgtgagcaca acagctcccccgggtactacgacggccgatactggacaatgtggaagctg cctatgttcgggtgcactgacgccacacaggtgctgaacgaggtggagga ggtcaagaaggagtaccctgacgcctatgtccgtgtcatcggcttcgaca acctgcgccaggtgcagtgcgtcagcttcatcgcctttaggccaccgggt tgcgaggagtccggcaaggcctaaactacgagttgaaacaatggcctatc tcgtatgaaggtcttttgtgaacttcacttttgtccaaaactctgctgta cgactctgctttctgaccggagcataccttttgttctatatgattttgtg tatgtatgtacgaacataggttcttgagcatgcatacgtaattcctcaaa aaaaaaa
Download
page-top