Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712716
Length 212 bp
Fasta Format > whva15g07
ttcgagganaaggacggcatcgactacgcggccgntcaccgttgcagctc cccggaggcgagcgcgatgcccttcctcttcaccgtcaagcagctcgtcg ccaccggcaagcccgagagcttcagcgggcccttcctcgtgcccagctac aggggttcgtctttcctcgacccaaagggccntggtggctctactgncta cnanaacgccgt
Download
page-top