Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712430
Length 259 bp
Fasta Format > whva13o08
cacgtccccgntcgcctcctagccccctgtttcccaccacctctgcttct ccggaagcccagacagcagcgcgggagctcctcctagctcaggatcggtg ggagttgatacgaggcggaggagatggcggatgcgaagcagcagcagccg ccgcagacggcgttggcggccagcggcgtctggaagacggtgaagccctt cgtgaacggcggcgcctccggcatgctcgccacctgcgtcatccagccca tcgacatgg
Download
page-top