Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712043
Length 729 bp
Fasta Format > whva11h24
gttgcaacacctaaattaggctacaatggctctgaggctgtgggcgagct cagctgccaatgccctcaagatttcaagcagcggcgccagggctgctgcc ccggcctattcgatctccagatacttctccactgttattgatggcttgaa gtacacttcctcccacgagtgggtcaagaacgacggctccgtggccacga ttggcatcagtgaccacgcccagggccatctcggggaggtggtgttcgtg gagctgccggaggccggcacgaaggtgagccagggcggagccttcggcaa cgtggagagtgtgaaggccaccagcgacgtcaactcgcccatctccggcg aggtcgtcgaggtcaactcaaagctgtccgagacccccggccttatcaac tcgagcccgtacgaggaggggtggatgatcaaggtgaagccgagcagccc ggcggagctggagggcctgctggactcggccaagtacaccaagcactgcg aggaggaggacgcccactantgctccttgctcgattatcgttcctttttt gttgcaaccatgtcgactactcttgtctacaataattaaaccancttcac catgcgttcanttcatcggttccagttttcttttgtcnttgtacatggcn tccancantttgttataccatttcantgaccgtgacatcanatatatggg gaanantttgtatgttantttnttgntaa
Download
page-top