Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712033
Length 791 bp
Fasta Format > whva11g23
agccttgctgaatcgatccgtgcaattgcggacatggaggaccctatctc acatacactgaaaaaaacagaggttgctaaggatttagttttcgagaaga tgtactgcccattgggtgttctcctaattatttttgagtctcgtcctgat gccctggtccagattgcagctctagcaatccgaagtggaaatggccttct tctgaaaggaggaaaagaagctatgagatcaaacacaatattacataagg tcataaccagcgtgattccagatgctgttggtaaaaagcttattggcctt gtgaaaagcaaagatgaaattgctgatcttctaaagcttgacgatgtgat tgatcttgttattccaagaggcagtaacaggcttgtttctcaaatcaaag cacaaaccaagattcccgttcttggtcatgctgatggtatctgccatgtt tacattgataaatcagctgacatggacatggcaaaacgtatcgtattgga tgcaaaggttgattatcctgcagcatgcaatgctatggaaacactacttg ttcataaagatctgaacaagacagagggtcttgatgatttattgatggaa cttgcgaaagaaggagttgttatttatggtgggcctgtcgcacatgacac attgaaagtaccaaaggtggattcatttcatcatgagtatagctcaatgg catgcaccctcgaatttgttgatgatgtgcagtcancgattgaccatata aatcgttatggaagtgcacacacagattgtattatcacaac
Download
page-top