Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712032
Length 758 bp
Fasta Format > whva11g22
cccttccttcgagcgtcgtctgcgagagactgcaagtgactgcctccgtg tgcgggtggtgtctgggagcggggatggcgacgcacttcgtgctcaacac cggcgccaagatcccctccgtggggctcggcacctggcagtccgaccccg gcatcgtcggcgaggccgtctacgccgccgtcaaggcggggtaccggcac atcgactgcgccagggcctacaacaacgagaaggaggtgggtttggctct gaagaagctgtttgaagagagtgtagtcaagcgtgaggatctgtttatca cctctaagctatggtgtggtcatcatgccccagaagatgtgcctgaggca cttggggattctctcgatgacttgcagcttgactacttggatctttacct tatccattggccatttagagtcaggaagggaacaagcattggcaaccctg aaaacttcttaccacctgacatcccagctacatggggagcaatggagaag ttacatgatgctggcaaagctcgtgcaattggtgtgagtaacttcgcgtc gaagaaattgggtgacttgcttgctgtagctcgcatacctccggctgttg accaggtggagtgccatcctggttggcagcaatctaaactccataccttt tgtcagtcggccggtgttcacctctctgcgtactcaccactangttcgcc tggttcaacatggatgaatggtaatgtcctcaaanaacccgtcgtcctct caattgca
Download
page-top