Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ712028
Length 711 bp
Fasta Format > whva11g17
gcctagtctggagaagaaatcttccaatacacctatcagatcaccaagcg tcaaaccataatcacctccctgaggccgtcaccgcaaggatcagcattga ggccgggtctaccctcggatggcaaaagtacgtcgggtccaagggcaaga ccatcggcatcgacaagttcggcgccagcgcacctgccccgaagatctac aaggagtacggcatcaccgcggagaacgtcatcgccgcagccaagagcct gtaagatcagcacactctgcgaggttctgtcatcgttgatgccaaagaac aaacaccacacttgtgaaggtctcgtgcccagaagctttggaataacgga gggagaggaggatatgcctgcgtcggagcgtgagtggtatttttaggcct gtaataaacaatgccttttccatttgcgttgtcttacattcgatatatat cgccccccttagatgattcgcggagggggcgagcctgatcaaattgggga ctggttttttgtatttgtttacatcgaactgatggtcgtgcttgcgatgc ttctttctctccccgagatcgtcgcctccatgggttttatgctttgatgc gcccttttagtccttggtagtttgctcatcttccccttcccccatacaaa cggtttgatgcatagtatcatcagtgcaataaacatagagtgttttccat caaaaaaaaaa
Download
page-top